Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216406
Length 553 bp
Fasta Format > rwh12b24
atttttacttgtctnaaggatctgaagagagtcgttgacaggaaaggcaa aacatatgctccatagcccatacagttatacccagaataccaatatgata ctaatacattgttcgagtgggaagttctggcacaacactgaacaaaacag ggatatcatcagcttagaagagagaggtccccttgcccttcttgtctcca ccgatctcaaagtgcttgcacctcttgatagcgcgttgcgagtaatgctt gcagctctggcactgcagcttcagcacaatcttctttgttgtcttggcct tcttgtggaaaacaggctttgtctggccaccatatcctgactgcttgcgg tcgtaacggcgctttccctgagcagaaagactgtccttgcctttcttgta ctgcgtaaccttgtggagggtgtgcttcttgcactccttgttcttgcagt aggtcttcttggtctttggaacgttcaccatggtcgccgcctggaagctc tcctccgcgcgtctgcttcttctcctgcggcgtgggcggcggtgaggaaa gcc
Download
page-top