Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ270348
Length 618 bp
Fasta Format > whoh7d06
gcttcttcctctgctcctgctcggatcccataccctgctcctcaaccccc ttcgcggcgcggcgcggcgcggcacagcacagaggagtcggcggagatgt cgggagtgacggcggacgaggacaagaagcccgcgggcgacggtggaggc gcccacatcaacctcaaggtcaaggggcaggatggcaatgaggttttctt ccgcatcaagagatccacacagctgaagaagctgatgaacgcttactgcg accgtcagtctgtggatctcaactccattgctttcctttttgatggtcgt aggctccgtggtgagcagacccctgatgagcttgagatggaggaaggcga cgagatcgacgccatgcttcaccagaccggagggtgctttcctggccctt agaaggagcttgctgcagcctggctgttctatgtcgtatgctacctttag aactagagtaaaatgtaagaagtgaaagaacttgtgaggctatggttctg tgccatagcctgagggggggtctggaggtgaaacaacatcggagtactgt tgatgtcgtgactgaactatcatccattgcctaatatatcatgccttgtt gtgttcccaaaaaaaaaa
Download
page-top