Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whsd_16050_o15f
Length 654 bp
Fasta Format > whsd_16050_o15f
CTATATACCTACATAGCACAGCCATGGCCCCCACCGTGATGGCCTCGTCG GCCACCTCCGTCGCTCCTTTCCAGGGGCTCAAGTCCACCGCCGGCCTCCC CGTCAGCCGCCGCTCCAACGGCGCTAGCCTCGGCAGCGTCAGCAACGGTG GAAGGATCAGGTGCATGCAGGTGTGGCCCATCGAGGGCATCAAGAAGTTC GAGACCCTGTCCTACCTGCCACCGCTCAGCACGGAGGCCCTCCTCAAGCA GGTCGACTACCTGATCCGCTCCAAATGGGTGCCTTGCCTCGAGTTCAGCA AGGTTGGGTTCATCTTCCGTGAGCACAACGCATCCCCTGGGTACTACGAT GGCCGGTACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGC CACACAGGTGATCAACGAGGTGGAAGAGGTCAAGAAGGAGTACCCTGACG CGTACGTCCGCATCATCGGATTCGACAACATGCGCCAGGTGCAGTGCGTC AGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTA AACAGCTCACTCACCACGGGCCACATATAAAGTGCCATTGCGGTTTTGTC AACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTTATCTTTCTTGTTTG TTCC
Download
page-top