Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ266989
Length 251 bp
Fasta Format > whoh3c06
cagacccctcccctcccctcccctcccccaacccaccggcggcggcgcag cgcagcttgaggaaggaagcgaagatggtgaagttcctgaagcccggcaa ggcggtgatcctgctgcagggcaggtacgcggggaagaaggcggtgatcg tgcgcgtgttcgaggagggcacccgcgaccgcccgtacgggcactgcctc gtcgccgggctggccaagtacccgaagaaggtgatccgcaaggactcggc c
Download
page-top