Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ266987
Length 264 bp
Fasta Format > whoh3c01
cttgtcgagctctccgtgaaccagtggccccacaagagatgcgacacctc cggcccgtcgcgccgctccgggcactcgtcggcgtggtcaagtcctgctg tctccctcctctcatggtggctgtcgtgtgcttggattcgcggncaagca aacaagcagcgctggccggcaaccaaccaagcaagcagtagcagcagcgc cagcttgcgaggaagcaagcagcagcagcagcgtcggctatcaaggaagc aagcagcagcgcaa
Download
page-top