Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208696
Length 207 bp
Fasta Format > wh10f21
atggtttcgctgtcgacttggttccgctacgccgcccacaagttcgagta ctccatctccctctcctggaagaagtacaccgtcgggcagatcaacagca ctgagatgactgatgctatctggaagagcttcttccagggcaagctcacc ttcccgcagtggatcaaagggggcgaagccatggcccccgtcgtggctcc gaccgga
Download
page-top