Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ270989
Length 560 bp
Fasta Format > whoh23j16
acccctcccctcccctcccctcccccaacccaccggcggcggcgcagcgc agcttgaggaaggaagcgaagatggtgaagttcctgaagcccggcaaggc ggtgatcctgctgcagggcaggtacgcggggaagaaggcggtgatcgtgc gcgtgttcgaggagggcacccgcgaccgcccgtacgggcactgcctcgtc gccgggctggccaagtacccgaagaaggtgatccgcaaggactcggccaa gaagacggccaagaagtcccgcgtcaaggtgttcctcaagctcgtcaact tcacccatctcatgcccacccgctataccctcgacgtcgacctcaaggag gtggcctccggcgcgcccgactccctcacctccaaggacaagaaggtggg cgccgccaaggccgccaaggccaagctcgaggagaggttcaagaccggca agaacaggtggttcttcaccaagctccgcttctaggccggccggccgcgc cagggcggtctctgccgttattactacccgaaccctttacatttttagtt gcttgttatc
Download
page-top