Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216137
Length 391 bp
Fasta Format > rwh10i13
tttgtgcaaatnctataggccagcataacatggcaagnacagcccctccc actaagcaaagctagtttgttattatctctttgcaacaccaacacaggtt ccatgccaccaatggtcacttctctcaggaggcaagtgtttccattacag cttaactagtaaccacccctcagagcaaggacaagatggaggaccgagcc accttcgatgttgtagtccttggcagtcttgtcatctgcaagctgcttac cagcgtaaatcagcctttgctgcacaggaggaatgccttctttctcctca acgcgctccttgatcctgtcaatcgtgtcggtgggctcaatgtcgatttc gatctccttcccagtgagagtcttgaccttgatcatcgtgc
Download
page-top