Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ217485
Length 249 bp
Fasta Format > rwh10h12
aatgaaacacggcagntnttcaaatctaacagactgcaacaacgcgccca agggcgtgtgaagtattgtcaacccgccccgatttgatccgaaaccgagg aacacccctgactgagagcttagagaaggggggcttgattccgcaatnaa ggcttgagagcaatagcaatgccgaccttcgagctcttatcnatggcctt ggtgtccaccttcgccgagatggtgcacagngactttggcatgaactng
Download
page-top