Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216133
Length 502 bp
Fasta Format > rwh10g24
acaacatactttgggtattacacagcctactgaacccaagnacagagcac aacgacgcacgccaaagcagtaaatcccatctaccacacaacacatgaca cagagcaaacgaggaagttgccccactactggcaccactagacgaatcta gcctccgaagccgtagagggtgcggccctggcgcttgagggcatagacga cgtccatggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacg gcgtcgcgtatgacgttctcgaggaagatcttgaggacgccgcgggtctc ctcgtagatgaggccggagatgcgcttcacgccgcccctcctggccagcc tccggatcgccggcttggtgatgccctggatgttgtcgcggaggaccttc cggtggcgcttggcgccgccctttcccagccccttgccgcccttgccgcg cccagacatcgtcgctggatttgtttttgtttgagagaagaaggactcgt gc
Download
page-top