Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216129
Length 659 bp
Fasta Format > rwh10g16
aacaccagttacactgcaaaatatatcagcactctttttacacacaaagg tgtggttattttgcgcacacagagcttccttcacttcgccgctctcaata agtcaaagtgctagtgaaatgatctggaaaatcgatagcagaagctatcc aatgcatctgttcttctgctgctatgtcctctgttcctatctaagcctgg gcatccagttgtcaaatctacctgcacaaaaatgaaagcatatggaatta tgaaaagttagtttcttgcataattagataaatctaaatagatggttatc atagatgaggtggcagcatggaattatttttcactacataaaaaggaagc acattcatgtaaaaaagcaatgccttctcaaacctatgtagattaattag gacctctaacaactctaaacctggatctccttttctagacaccaaacttg gaacatcaaagagaaaatggtttcgtcaatggaccaacctacaggagagc aacatgcatatggacaggaactgtagcagaagaaaacatgaactgtattt agtataggaaccgaagcttcatattaaatctcagaaaaggagaatatgga caggaactgcagcttcatataaagtccttgtctttaaagttttggtacgt tcctgttat
Download
page-top