Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ217480
Length 645 bp
Fasta Format > rwh10g09
aaacttcctaaccccagatagtnacaaaactatgtttctggaatacattg atagcacaactaaccaagacctcaaccaaaacatttggatcagaaagata tgaaatggagacattcaaggcatggatcttcaggcggtttcagtcacagg gtactcaaagacaacgtctttcccacaaagcctgcggtagactgcagaga aggtctccagcttgtattcagtgttgttgcgctcctttgggtccaagtag atcttgatgaccttggcaccatccaaacggtatctgacacgcttccccac aatctcagctgggtacacgacatcctccaagataccatcatgaacagctg tcagggtcctggtgcgagggcgctgaacagcagaacccttcttgggtggc ctcacaatccttcttgttgcaacaaagaccacatccttgccgctaaactt cttctccagctccctgacgagcctgacatggatcttcctgaagggcttgc gcagacggtacggcacatggatcaccacggccttcctgttgccaacaaca tccatctggattgcagtgttgatgtacaggtccttgaggtcgctcttgag ctcctggttgccattctccaggtcaaagaaagcctgcgcgacggt
Download
page-top