Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ268465
Length 645 bp
Fasta Format > whoh17b23
ttctcctccgcctccggtctcgagagctcgccagaatggtcgcccacagg ttccaccagtaccaggtggtgggtcgcgcgctgccggcccccggcgatga gcagcccaagatctaccgcatgaagctctgggccaccaatgaggtccgcg ccaagtccaagttctggtacttcctgaggaagctcaagaaggtgaagaag gccaacggccagatgctcgccatcaacgagatctttgagaagaaccccac cacaatcaagaactacggcatctggctgaggtaccagagcaggaccggtt accacaacatgtacaaggagtaccgtgacacgaccctcaacggcggggtg gagcagatgtacacggagatggcgtcgcggcaccgcgtgcgtgccccctg catccagatcatcaagactgcgacggtggacttcaagctgtgcaagaggg acaacacgaagcagttccacaactcgaagatcaagttcccgctggtgtac cagaaggttcgcccacccacccgcaagctcaagaccacctacaaggcgac gaggcccaacctcttcatgtgagcgggtccctactctactggcctgtgtg ttttagcgtgtaagagtttgaagatttttgcatgtggaagttttg
Download
page-top