Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216126
Length 150 bp
Fasta Format > rwh10f22
caccaaccatgtctttaaccgntaaataagcaacaaaacgcttgtcttna tgcatcagaagatccaacatacgaagaaaacatttcaactcttaacagca tccaccacagcccaatcacatgaacaagttcggcctcgttgccttgtttg
Download
page-top