Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216123
Length 482 bp
Fasta Format > rwh10f19
acttgtacagcatttgttttcctttgtgcaccaggtttagacaaaaggaa tcgaaaaaatcaacttagcagcagcgactagtagatatacttcacgagga aagcatttcgggcgatagagtacaaatcaatcctcaggccaactagcatg aacagaaagtcatcttgatgacttcaagatagatggaatacataatgcat gttgaaatgaccacagagcctcctcagatcctcgagctataaaggcggat agccgactcctatgcagccgtgttattggtccacggagctacagccctgc gtcgcaaaaaagatgcaatcacagcgcgcagccgctggacctcatgattt ggattctgggcgttgttgtttcaacgccggcggccggagagggagatgga aaggagagagatagggacttctcnacgaanaggagagggagatcnaggga canaggtgcctcntgccnaattcctgcanncc
Download
page-top