Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216120
Length 602 bp
Fasta Format > rwh10f15
tcaatactacaatgatatcaagntctgtcggnagtggcgagtacagagta cagagcggacatagtaaagccatgatgggcaaacaaacagcgccacggac aatttaacacccacgaaaacaatctgatagctagctctttgacagagagc tttatctttccaaaacacccacattatctgtcaagactatatagtttata atacgtaaaggcagtattagtccgaatatccagcttatccagatccatag aagcccctgccgagatgcttcaagccttgttggcaatgttgttggacagc cagtcaaggccctcgtacaacccctccccagaggtagcacatgtgctctg gatgtaccagtgtcgctggcgcagggaatgcaggccaagcttgtcagtga tttcagcagcattcatggcattaggaagatcttgcttgtttgcaaacacc agcagcacagcatcacgcagctcatcctcattcagcatccggtgaagctc atctcttgcctcaacaacacgctctctgtcattgctgtccacgacaaaaa tgagaccctgggtgttctggaagtagtgcctncacaggggcctgatcttg tc
Download
page-top