Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216116
Length 404 bp
Fasta Format > rwh10e18
atcttacataacacacaagtccaggnaattacagagtncaccggctagtt aaaacatgcatgatatatatagtactagtagatagtagaacttgcggtgc aggatatagcactagtagataagtagaacttgcgggtgcagtagtagata gtagaacatgcggtgcaggatagatattccagtcattcaccattgagcca tctccttcaaccaagccgatggaccccaagcaaaaaggtgagtgctccaa gactgaagccagcaccacaggccaaggcctcgttcctgcgcctcttcctg tgtttctctacaatcttgtccagtgcccggcgaaactctgggccgaagcg gtcgaagtcagcatcagcaggtgccggagcacgagaagagacgcgaaccc gctg
Download
page-top