Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216115
Length 445 bp
Fasta Format > rwh10e14
ttcacatggattcatcaagctagcaacaggtagtcaattagtaaatataa cancatagtatcggaatagatccattgtcaccgcaagaatttattctcaa gttcttaagccctgaccataaatcaacaacttctcaaaacatcaccatgg cacccgatcttcattcatcatctgtgcgcacagtgggcttctgctgcttc tcgtcggcccacttggagagggagaagtggaccttctcgcgggaggagac ctcggtcttgaagggctccttgaggcagctccgcaccagcgccgcgcaga cgttggagtagccgatgtaggtcatccccgccgcgcgccagaagggcacc gccgccgtcatcgccgacatcgtcgcctccgcttcctctcctctgctttt ttttttctctgctagggtanaaagcttcctttcctctgctcgagc
Download
page-top