Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216114
Length 561 bp
Fasta Format > rwh10e13
tttggcaaaacatacatagggtgcgggacgggaaagggaaaaagcaactt ccagtattaccagaaaacccactgcgcacactcgcaatcggcttgtgcac tacgtggcgaaaacctggtaaagtgtttcgtatatacatacacgtactag tgattcatagaaataaactagtaggagtagttgtttatattgatctcagg attcacggtctttgctcgctccacatataatgtcgatcgatcgatgaatc ctctacgacgaactgatggcatatgcaaggcctgatcatggatacataga tgcataggtcgatcatgactcaggaggatgccctgccgacgtactcgacg tcgaagaggagcgtggagttgggcgggatgacgcaggaggtgggctccca ccccctgcacccggcccccttctccccgtaggccagctccggcggcagcc tcaggctccgcttcccaccgactctcatcggcgggatcccttcgccgccg gcgaggcacaggtcccaccccttgatcacctcccccacgcccaccatgat ggtcagcggcc
Download
page-top