Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ217477
Length 373 bp
Fasta Format > rwh10e12
aagaagaagaaaacaagcttttacccttttgttccacacgagatttctgt tctcgttgagctcatcttaggacacctgcgttatcttttaacagatgtgc cgccccagccaaactccccacctgacantgtcttccgccgacatcgaagg atcaaaaagcaacgtngctntgaacgcttggctgccacaagccagttatc cctgtggtaacttttctgacacctctagcttcaaactccgaagatctaaa ggatcgataggccacgctttcacggttcgnattcgtactggaaatcagaa tcaaacgagcttttacccttttgttncacacnagatttncctngtgccga nttcctgnagaccggaggatcca
Download
page-top