Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ215907
Length 474 bp
Fasta Format > rwh10e06
taacctggtaactatggncatccaaagatgtnccgtnttttgctgaactt gggatgcttgatcttccatgttctnttttntttgaagggaactttatcca cttaaacttacaacaatctntatacctanaatggtttttatgccgggtga caaacaacanatgaaagttcactttcactganaacatacctcggncatat tttttaggtctataaacgatccgaaaagagcgattgaatcanatnttatt atgganattaacaaccaagtcatgcncatcatntanaagcctccanacgt caagctgcccagccatgctntggcactcccgcagtatctnatccatgctg ctgtacctntcgatgatcagcctcctcctntgcaggacgcaggccgcaat ggcataaagcaacaaatcgtcggttggaggagcatggagccttatccttc cccatgtggaccttccgatcccag
Download
page-top