Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ215906
Length 544 bp
Fasta Format > rwh10e03
ctaacattccccctacagtcgtagcgggagtgaagcggatgattacgaat gaatttggagtcttgtgcttccgtcgtcttctccgctgcgccatcatcag tacgactctgatgggtcgacacctagggcgatgactgcgtccccttttgg tgcctcccttgtctctcctctattccctcccgcaatcatagcgggagtgg cgtggatgctggtgatgacacggacgctgttgactgtagttgccgccgat gtgttgctgtagacgtggtcgtgtgtgtcgatgtcgatgtaaccgtggtc gaggtagtcgtggtcgatggtgtggtcgtggtggatgatgaaaccgcaca aagccggaggcgcaaaaaaaatgcactatgacggagctgcagacgtggac agtgcaccttgcggatgtcagagggtgtcgtcggtgatgagtcaattggt tttgccaggaccggaggaaacccatcgagcacacatccgttttgccagaa ccgtgcgaccgtgtagggncgtcactgtagtgatgccatgtcga
Download
page-top