Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ215904
Length 562 bp
Fasta Format > rwh10e01
taactgagaatgcatcggttccgatcgctcatctctcatctttctataca gcaaggtgaacaaacaagatggatcaaagaaatctaccgaccgggcgcct tcatgatccgcgttcttgctggctactaattttcctccgcggggcagggc actcttctctgttagcaatccctccaatggatcctcgttaagggatttag attgtactcattccaattaccagacactaatgcgcccggtattgttattt attgtcactacctccccgtgtcaggattgggtaatttgcgcgcctgctgc cttccttggatgtggtagccgtttctcaggctccctctccggaatcgaac cctaattctccgtcacccgtcaccaccatggtaggcccctatcctaccat cgaaagttgatagggcagaaatttgaatgatgcgtcgccggcacgaaggc cgtgcgatccgncgagttatcatgaatnatcggatcagcgagcagagccc gcntnagncttttatctaataaatgcgcccctnccagaagncggggtttg ttgcacntatta
Download
page-top