Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216111
Length 757 bp
Fasta Format > rwh10d18
attaatnctgaaatagaaattaattcttaggtgagacatgtgatataact aaattcaaatgaaaatagcatatttttattctcatatgatataacacaac cgtcaagtgcttattaatatattttccctaaatggcagtgagcactgcct ggcttagttttacgccttttgcacgcaaagctgtcaacctcttctccata atcatcgttgtcatcctcctttgttttgaattttgaagaaatgcgggagc aacagtcaccaacgtcttccacgtaccatatttcgtcgaacaaggtagac acatatggatcggtctctccgtatccttcttcgatctcgaaacatacatg ttgctgtgctagtagcagcttatcttccttcacgacctgattagttgttt ttttaatgtaacaacccacggatgcctctccagaatagttctcatcaagt atatctccaacctccatcacagctatggctgttgacataggaggcctgag cactattcgctccgcatggatctggccaccagacctcagcctcttagcca ttcttgaaattcaaaaatatcttatggatataaaagctttgatgaagccg caggtctaactcacatttgcaagtataggctatgtgcctggagaacagcc gttgcttctatatatagaacaaagacgatcgcacgtgcttggtcctgctg tcgttttttgaaatttgaatccggcactgattgtattaattgcaggccct tcgcccc
Download
page-top