Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216110
Length 171 bp
Fasta Format > rwh10d17
cgtcgagccagtgccagaggaacaccacgaggctccccacgcacatgtcg atggcgaagctggcgccgacgaggaacggcacggccatggccatgggcag cggaacgaacctcccgagccgccgcggcaggaagtccctcgccaggttag ccagcacggcgaaggcaaagc
Download
page-top