Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216109
Length 561 bp
Fasta Format > rwh10d16
ttaaatttataaaaactataacccaggnagcagctcaattcagactaagg tttatcagttcgcttaaataaggtgtccaataccgacgatgtaccactca agacaaggtttctacataaacagtagctcaacaccgcagctccagctggt atatattttttatcaggtaaagaggagcccagcataaagcaatcgacacg cgaaatcgatggatctcttcactcccctggtgcagaaaccccttgcttca gcttttccctcttgagcttcttcttggagactggcttcttcttcttcgga gggagcgtcttctgcgcatacaggtacagcgcatagttcccaacaaagaa aagcagcagggtggtagcaaccacaagcaggactatcattccagggttca ggcccttgttcacctcttcgatgattacattgttcgctgactccgcgaac ttctccgccatggcggccacgagatctggaccaggcaccgcgccctcctc gccttctgaaccgagagattggatggattaggccaggggcgagtaggaga taagcactggc
Download
page-top