Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ217472
Length 508 bp
Fasta Format > rwh10d08
cgaattacagaggatgtaaccattgtcccacctagtttagcatcggtaca agcacacagattcagaaactaatagtagtactaacatcctagtagtagta aaacgcaacacctaggcaacacttaactgaacacgctactacacagaact ggatacagccgagcacccacgacctcagaggaggagtcgtcatctagcta tcgtcgtcggcagccacggccttgctgcctccggccttcttggggagcag aaggttgtggatgttgggcatgacaccgccgctggcgattgtgaccatgc cgagcaggcgggagagctcctcgtcgttgcggacggcgagctggatgtgg cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggccaa ctccagaacctcagcggcgagatactccagcacggcggcgaggtanacgg gggcgccggcgccgaccctctcggcgtacttgccggccttgaggaaccgc gcgatnct
Download
page-top