Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ215902
Length 617 bp
Fasta Format > rwh10d04
tgctcttcgaaacnaaccaatcgtctatgattcgattatcgtgacggtaa caggaacacaagaagagatccggaacgcagacagcgtctgcaaaagcttc atcagcagcagcaaactcacacaaggttcacatgagcgcgaattaacaag ggtggcacggcgccaagttactgcgccagcttaattcctacaagtactta gcagtggtggtggtaccangtagcggcggcgacgatggtatctacgatgt gcagatgacacacgttcaggacctcctcttcctcttcttcttgtcctccg acttgtcgcctgcgttcttgagcatgatgatgaggacgcggacgagaacg gcgacgaagtcggtgaagagggtgagcgcgtgcttgatgtaatccatgtc gccgtggtgcgccctctcgatgatctcctgcgtgtcgtacaccatgtatc ccaggaagatcaacaggccaaagtaaacctcaaacatgaagctgccagag gagtggccaaagatggacgtggcaaactgcagccagagcaggatcgacag gccggaggagagcagacnaccgaggtacaggtactccctgcgcttggcga tgatggcggcgccagag
Download
page-top