Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ215901
Length 289 bp
Fasta Format > rwh10d01
acggctgatacaaggagctgaaagaaagcaaaaacgctacgacnaatgaa gaaaaagactacagcttgagaagctgctgcccacaattgaagcatgccac acacgctagctatagaacaggggatcccaagaagacacggccatgattgg aacaccaaagccaccaggaggaaacagannncgcnatggccaccatctca cctaccatcacatnctaatngacgtngaggggaccactatcccctcttgc ccangccgagggcgttgatncntcggactgncaggacca
Download
page-top