Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ217470
Length 250 bp
Fasta Format > rwh10c09
tacacggtanaatngttgcacactgacaagtgagcccataatcggatatt acctccgtagcaaaaagttaaacgtttttgaatgctagttttagcctaca aaaaacgtcttctattttgatacggaggtagtacatgccacatggagatt cctaaaaataacaatctcatagacaaaattgtgctacaatccgacatagc ccctaattttttttttcttttctttntgaanacataagccctaactaana
Download
page-top