Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ217469
Length 577 bp
Fasta Format > rwh10c08
ccgcaatctgttttggtnaaattacattcttgctaaaaatctctcctcta ataaaagaacacaaagctcagcaagagcatcctcctgctttctgctcctg ctgcccaggcgcgcctgagcctgctggcccggaggcgggcctcaggttga tgtccaccatgtcctcctgcttcgccgacgagagggcgtccatcccaggc agggacgcggcgatcgtgcggaacagagccttgatgttgaagccggcctt ggcgctggtctccatgaacaaggcgccgtgctccttggccttggcctccc cttcgtccgtgggcacttgcctctggtcaacgaggtctgttttgtttccg acgagcacgatcagcacatctttgcctcttgccgtgttcacctcatcgat ccacttcgatgtatgaagaaacgattgcgtgtcagttacatcgtagacga tgaccgcgacagaagagtctctgatgtagcttggaatcagactccggaac ctntcctgcccagccgtgtcccatagctgcaggcgaaccgtgcggtcctc gaggtacatggtcttggagaggaaatc
Download
page-top