Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216101
Length 563 bp
Fasta Format > rwh10b15
acattacattagggtcgatatcaataatatacatacataacagcacaatg atcaattgtacatatacaccatctagcgctctagctaggccctaaatcat aacctaatacttcacccttcttatcaaccactgccatcagctagacaatc aacaacgttcctcgcctttggataaggcactcaacaatacaagagaaaaa tgagactgctaaggtcagtctgttattcatttgcatcagctggattccag attgaatggctgcaggagttgagcagactttcgccttcgctttccttcag gagtcaatctgactgctgccttgactgaaaccttgccatttttaggtggc tgcttcttagaggaatttagtcgtacccgagagggctcgccctcttcacc acaacttctctgaggggacttgactctcttgcgtgcaaaacgtgcctcca tctctggtctacggttgggaccaatcagctttacatggaatggattgaca gctgtgtagcaaaccaagtcatttgtagcttgtcctttgtccagatcaac acttctgccgttc
Download
page-top