Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ217466
Length 493 bp
Fasta Format > rwh10b09
ttactgggtctgggttntagatggacaacagacgttacatatcctcaaat gacccaacgacaagctcatgcatatcagcctgggtggagtacaaagtatc acaggaacgctcaacataggaacgacaacgccagccatcctagagagaga agcttcactttccagtgttcatcatcagagttatgttgtcgcctttcaag agtatccttcccaacgatttcctggtgttcttcttaatgttgatttcctc agcatcctcgagaaccaggttcatgtactcatcaaagccgatgatacgac cctcgatccgcatatccttctgctcgaaaagccagatctggatgcgcgct ttgctctggaggaaccgaaagatgaggttgatgggctgggtcatgatacg ctggactttggtggacgccatggctgctgctgcggcgtgagctcctcctc cgactggaagtgtctagaagcttctggacggaaccgcgtgtgc
Download
page-top