Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267853
Length 650 bp
Fasta Format > whoh13k03
tgcaggnaattcggcacgaggtctctctctnactcgctccgcccggccgc ccgactttgaccgcctcctcgtctccgctcccacgcccgcgggagagagg cgaccggcggcggcgcgcgaggaggggcctacccacccatcccaccaccc cgccggcgaagatgttcggccgcgcccccaagaagagcgacaacaccaag tactacgaggtgctcggggtgcccaagaacgccgcccaggacgacctcaa gaaggcctaccgcaaggccgccatcaagaaccaccccgacaagggcggag accccgagaagttcaaggagctggcacaagcctatgaggttttgagtgac cctgagaagcgtgagatctatgatcagtatggcgaagatgctctcaagga aggaatgggtggaggaggaggtggtggagttgatccatttgacatcttct catcatttttcgggccctcttttggaggtggtggtggcggcagcagcagg ggcagaaggcaaaggaggggagaggatgttgtccatccacttaaagcttc tctagaagatctttacaatggtacctcgaagaagctctctctttcccgta gtgtcctctgctccaagtgcaagggcaagggatccaagtctggtgcttcc
Download
page-top