Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216097
Length 321 bp
Fasta Format > rwh10a21
gatagtattgtgagcagaaatttacaatncaagcatgtaggctgggtcag gaaggactgtgccccgcattggtaggtggcggcaccaaagttggggcagg ggagtgtgcgtctccactccgtcacgtgatatccatcggacatcaccaaa cgatctccggggacantgaagcgatggtggcttcttgctttgccagttca agagccccctattatcggtctcgggccacccttattccttcaccagtgtt gttggtaggccaccgacgaaactgactgttgtaggaggtgcagccccaat tctcagnctcttggtccaacc
Download
page-top