Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ217465
Length 577 bp
Fasta Format > rwh10a12
ggggaagtaatcaagtatcacatgttcgttttgacaaaatgatataactg atgatgcgcggcggcagctcaagccttgagcttgccgtagaacctctgct tctcgtctgtggtctggaagcgaccgtggccgaacttggaagaggtgtcg acaaacttgagcttgatctcctccagggccagacgagaggtctgcttcag cagggactggcggagggtcaccacgcgcttcttggggccgacacagcatc ctttgatcatcaggtagtcagccttcaccacaccatagtgagggaagccg cccatcggagtgatgtccttctcggtcctgtcgaactcagtagaggcatc atgagtttcctgtccaaccttgccaatcttgtagaccttcttgttcatct cagttcggtggtggtatccattctgaccagcacgagcaacagtgtaggac accctagcaggatgccaggcaccaatacaggcaactaaacacgagggttg cgctcgttgcgagacttaacccaacaccttacggcacgagctgacgacag ccatgcaccacctgtgtccgcgttccc
Download
page-top