Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267246
Length 415 bp
Fasta Format > whoh10j01
ggnctgcaggnaattcggcacgaggagaaacctctcatatcaaaacccta agcaggtcggcggcggcggcgcaagcatcccctactcaccccaggcccag cctctcccctcccatccttccccaacatgctcccccagatgcgccccctc ccttcccgcccagccatccacgccgtccaccggcgcacctcccccgcgcc gccctctatcggcggacttgggcagcatggccgagtggccctcgtgagga cgaccaaggccgtggtatgccgctccgtcgccagcccggcagcgaatcag ggggcgccagcggtggagaggccttggaagcttagcgacgctcgcctcgt tctcgaggacggctccgtgtggaatgctaaatccttcggtgcttccggga ctcaagtaggcgagg
Download
page-top