Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267245
Length 471 bp
Fasta Format > whoh10i24
tgcaggnaattcggcacgaggctgaagacggtcggtgactggttcttcga gnaggggcaacgccaagtacaccgactgcgcgtacccttgcgacggcaca tgccatcaccttgtgttcaaggggaggcatctctaatatgatcatatcct ttgacaccagcagctgaagtgctgaaaacccagtgagtgggcacaaccga aaaaaggagggtatagatagaagatgggtgcaagttggtggcttgcccgg cgtccatcgcctgagataagatatgatagggcagggcctcgcatgcaaac gctacgaggccctctgcgttattttagcttcacatgttgattctttccat ttgccaattgttattcgctcgatgtatctgaatatttggaccacactggt gtataaccttacatattcatgtattgaatgtgataatatgaatgaataat gtgcttagttcaaaaaaaaaa
Download
page-top