Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267241
Length 555 bp
Fasta Format > whoh10i18
attcggcacgaggacgcaacagcccggcgcgcatctcgctcggggagctc cgccgccgatccgcccccctccccctcccctcgctcgcccgccatggagg aagccaaggttgtggagaccagggatgggactatcgcagttgcttcagcg tttcccggtcatcaggaagcggtacaagatagggatcacaagttcttgtc gaaagcggtagaagaggcttacaaaggagttgactgtggccatggaggcc cctttggcgcggttgtcgtccgcaacgacgaagtaatagttgggtgccat aacatggttttgaacaacaccgatccaactgcccatgctgaagtcactgc aataagagaggcttgcaaaaagcttgggaagattgagctgtcggattgcg aaatgtacgcctcatgtgagccttgcccaatgtgttttggggctgttcat ctatcccggatcaagaggctggtgtacggagccaaggcggaagctgctat tgccattggattcgacgacttcatcgctgatgctctgagaggaaccgggt tctac
Download
page-top