Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267240
Length 509 bp
Fasta Format > whoh10i17
attcggcacgaggttcatcttctcccccaaatcgcccccaaatcaactcg acctgccctccaccccaccgccgccgcccccaatctcatgtgccctcgcc accgcaaccaaccaccgcacccccgcctacgcccccagccaccccgagtc cccgaccacttccttcgtcgcccccaacaccccatcacagcgtcgccgag catacatctgacacggatctaagccgccgccgaccggccccgtcgccgag ccactccaccgccgaccactgccctccgccgtccactgtcctttgccacc accatactctgcgagcttcctcccccgagcaggacttgtcaccagagcac cgaccaagcctgcctcctctacgtcctctgccccaagcaacggagcgtcc gtcccctcccgcgagcagctctgcctcctccacttccttgtcccaaacca gagcatttgataggttgcaagttgttgggtggccgcctattgggagctac cggaagaac
Download
page-top