Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267236
Length 487 bp
Fasta Format > whoh10i11
tcggcacgaggctgcctcctcctcgatctcccattctcaccttcccgtcc cccagcaccgccgggacattcctcccgaaccgtcgccatggcaaccgccg ttccaccgatcatctccccgaaggaagatctcccccctccactgacctcc gcctccgagccccctccgctcttcgacggcaccaccaggctgtatcttgc atatcactgtccgtacgcgcagcgcgcttggattgccaggaactgcaagg gtttacaggacaagatcaaggtagtcgccatagatctggcggacaggcca gcttggtacaaggagaaagtttacccggagaacaaggtgcctgccctgga gcataacaaccaggtgaaaggagagagcttggatttggtcaagtacattg acagcaattttgatggcccagcattgctgcctgatgattctgcaaagaag cagtttgctgaggaactgcttgcgttcagcgatgggt
Download
page-top