Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267232
Length 616 bp
Fasta Format > whoh10h22
tcggcacgaggctgtggttcactggcagaggaggggacagtcattaagat cggtggcacgttgcaaagctctcctttatcgaatgttcctctggtcacga aaaagggtccagaatcatgccaagatgtagatcaaacggacgatatgcgg aaagaggaactacggactctcactaactcagaacatgtagatccagaact cagagatggtgagctagatgaaggccgagaaactagtgctctagttttag ctgatgctctaatgcaagagagtgatggcatgcacaacggcccagttgat gaaaacgctaaagacgacttggaggccttccctcccaaatctgtagcgct gcatcggttgagatggaacacaaatagaggcagcgagagatggttatgct atggaggcgccgcaggcattattcgttgtcagaggatctaagggacaagc atatataattgggccgcaaaccaggagaatccgtgggtgtccacccatct acacaataagctgttgcagcagcaatatatggtaggtttgcctgattttt gccgatttccgcagttatggctgacagagctagctgtgtatcttagcaac tccaacagcagcagat
Download
page-top