Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267228
Length 519 bp
Fasta Format > whoh10h13
cgaggcagcgctgaagaagcggaaaaccccaggcgcccaacgaccttcct tccgtcgaaaccatccgactcctccctcgtcttcctgctcgccgaggctc agctcaggataaaccatgggtggcgttttaggtttagtgcaggttgatca gtcaactgtagctatcaaagaaacttttgggaagtttaatgaggtcctgg agcctggttgccacttcttgccttggtgcatagggcaacggattgttggt tacctctcactgcgcgtgaaacagctagacgtccgatgtgaaaccaaaac aaaggataatgtctttgtgactgttgttgcttctgtccaataccgtgccc ttgttgataaggcatctgatgccttctacaaactgagcaacacaaagcaa caaatccagtcgtacgtctttgatgttattagagccactgtcccaaagct ggagctggacgatgcatttgtgcaaaaagatgacattgcaaaaagctgtt gaagaggagccttgaaaag
Download
page-top