Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267227
Length 591 bp
Fasta Format > whoh10h11
aggaattcggcacgaggctntaatgagatggtagtggcccagatgaagca aatgagcgaagataatcaacaactcaattatctgaagaacaaggtggtta agacagagcagcgctctaaagttgtagaagaaaccctgggtgttattacg cagaaacttcgagagactatggaagagaatatattcgtcaggagtaaagc taaagagaagcactctgagtatgaggaagagatgaaatcccaggaaaaat tcttccatgatcagatagagaacattcacaaggccacagaagacaaggaa agcgagtttgagaggttgctgcaggaggagcgtgcaaaggctagacagtg tgatgtggattctgggactactgaaaatcgcaggctaaggaaggaacagg tacagcggttcatagagtgccaggttaaggacgtgcaggagtttgaggct gaaagggacgaattgataaaagcgcacgaggagaagaaggtgcagctgaa gaaagagtacatggcaaaggaggtggagctcgagaaggagtttgatgccg ctctcaccggtttgatggagaaacataggccaggcaccttc
Download
page-top