Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267226
Length 566 bp
Fasta Format > whoh10h09
ctcccatccccgtctcgcgtcgcagcggcagttccactccctcgccatgg gcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtc gccagggtcgccctccagagcgacgatgtcgagctcgtcgccgtcaacga cccctttatcaccaccgagtacatgacctacatgttcaagtacgacaccg ttcacggccactggaagcacagtgacatcaagctcaaggacgacaagacg ctgctctttggcgagaagccagttaccgtcttcggcgtcaggaaccctga ggagatcccgtggggtgaggctggtgccgattacgttgtggagtccaccg gtgtcttcactgacaaggacaaggccgctgctcacttgaagggtggtgcc aagaaggtggtcatctctgccccaagcaaagatgcccctatgtttgtggt tggtgtcaatgaggacaagtacacctcagacgttaacattgtctcaaatg ctagctgcaccactaactgccttgctcccctagcaaagatcattaatgac aacttcggtattattg
Download
page-top