Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267222
Length 615 bp
Fasta Format > whoh10g22
cgaggcagaagccccgacgctcaagncccccagtacgccgcagcgccgcc actccacccgcagcggcaaccatggcggtcggcaagaacaagcgcatctc caaggggaggaagggtagcaaaaagaaggccgtcgatccgttcaccaaga agcagtggtatgacatcaaggcgccgctgctgttcaccagccgcaacgtc ggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg tctgaagcacagggtgttcgaagtatctctagctgatcttcagaacgatg aggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaaggg atgaatgtcctcacaaacttctggggcatggacttcaccactgacaagct caggtctcttgtgaggaagtggcagacactcattgaggctcatgtggatg tgaagaccactgacaactacatgctccgcatgttcaccattggcttcacg aagagacgcccaaaccaggtgaagcgcacttgctatgcccaagcaagtca gatcagacagatccgccgcaagatggttgagatcatggtcaaccaagctg caagctgtgacttga
Download
page-top