Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267219
Length 641 bp
Fasta Format > whoh10g18
ggagaaaaaaggttcgagtgcgttgcagagtgagaagagatggctccggt gaagctgtacggcgcgaccctgtcgtggaacgtcaccaggtgcgtggcgg cgctggaggaggccggcgtcgagtacgagctcgtccccatcaacttcggc accggcgagcacaagagccccgaccacctcgccaggaacccctttggcca ggtgccagctttgcaggatggtgacttgtacgtcttcgaatcacgtgcta tttgcaagtatgcgtgccgcaagaacaagccagagctgttgaaggagggc gacatcaaggagtcagcaatggtggatgtgtggctcgaggtggaggccca tcagtacaccgccgctctgagccccattctcttcgagtgccttatccatc ctatgcttgggggagccactgaccagaaggtcattgacgacaaccttgtt aagatcaagaacgtgctggcagtgtacgaggcgcacctgagcaagtccaa gtacctggctggagactccctcagtcttgcggaccttaaccatgtgtctg tcaccctgtgcttggcggctacaccctacgcatctctgttcgacgcgtac ccgcatgtgaaggcctggtggactgacctgttggcgaggcc
Download
page-top