Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267215
Length 537 bp
Fasta Format > whoh10g06
ggtacgtttccaagnatggtcccagcatctgatgtgggcagatttttcgc gtttggtcgtgtcttctccggaaggattgcagctggcatgaaggtccggg tcatggggccttcctatgtccccggcatggaaactgatttgcacgtggag tctgtccagcgtaccattatatggatgggaaagaagcaatgtgacgttcc ggatgttccttgcggtaacactgttggtttgattggtctggatgcatgca taacaaagagtgctaccctgacaagcgagaaggaggttgttgcacgccca atcagagcgatgaagctctctgtatgccctctgatgtttgttacaattaa ctgcaaggttccgtctgagtctcccaaacttgtacaaggtttgaagcgtc tggcgatgtctgatcccgtggttctgtggagcaaggtagagcctggtact tacacagttgctggagtgggagaacttcatctggaaatttgcttgaagga tctacaggaagagtttatggatggtgttgaagttgtt
Download
page-top