Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267212
Length 527 bp
Fasta Format > whoh10f22
ggnctgcaggnaattcggcacgaggatccccaattccccaccaccgacag cgtcggtgagagagatggcgtcggcgacggagatgcagccgctggcaccg tcgggctaccgccgggcgccggagatgaaggagaaggtggaggcgtcgtc gatcgacctggaggcggggaacggggagacgctctacccggggatctcgc gcggggagaacgccctccgctggggcttcatccgcaaggtctacggcatc ctctgcgcgcagctggtcctcaccaccgtcgtctccgccatcaccgtctt ctaccccaccctnaacgccacgctctccaactcgcccgtcctcgcgctcg tgctcgccgtcctccccttcatcctgatgatcccattgtacatctatcag cacagacaccctcacaatcttgctatcttgggtttgttcactctgtgctt gagcttcagcattggtgtggcttgtgcaaacactgaaggaactattgtgc ttcaagcattggtactgacctcagctg
Download
page-top