Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267210
Length 428 bp
Fasta Format > whoh10f20
cgccgccacccaccccctcatcctcttcctccgctctctgcagctgccgc tcatctcggtgggaggtcctcaggcgggcaggttcccctagatccccgga gtcactcaatcaaatggctgacggtgaggacatccagccccttgtctgcg acaatggaactggcatggtcaaggctggttttgcaggggatgatgcaccc agggccgtcttcccaagtatcgttgggcgcccccgccacactggtgtgat ggtggggatggggcagaaagatgcatatgttggtgacgaggcccaatcca agaggggtatcctcaccttgaagtacccgatcgagcatggtatcgtcagc aactgggacgacatgggagaagatctggcatcacactttctacaacgagc tccgtgttgcacctgagggagcacccag
Download
page-top